pcmv vsv g (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
pcmv vsv g
Pcmv Vsv G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv-vsv-g/pCMV-VSV-G+(Plasmid+%238454)/pmc12907852-54-26-27
Average 96 stars, based on 3107 article reviews
Pcmv Vsv G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv-vsv-g/pCMV-VSV-G+(Plasmid+%238454)/pmc12907852-54-26-27
Average 96 stars, based on 3107 article reviews
pcmv vsv g - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Western Blot:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Plasmid Preparation:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Expressing:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Transfection:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Next-Generation Sequencing:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Produced:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Titration:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Real-time Polymerase Chain Reaction:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Recombinant:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Modification:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Software:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This Virus:Article Title: Cell‐Type‐Specific Autophagy in Human Leukocytes Article Snippet: Western blotting was used to verify LC3B KO. psPAX2 was a gift from Article Title: RalGAP complexes control secretion and primary cilia in pancreatic disease. Article Snippet: Next-generation sequencing and data analysis were performed by the Core Facility Genomics of the Medical Faculty, University Münster. pLKO.1 puro and pCMV-VSV-G plasmids were a gift from Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress Article Snippet: The following Article Title: Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress. Article Snippet: The following Article Title: Heat shock protein family D member 1 mediates lung cancer cell‑induced angiogenesis of endothelial cells Article Snippet: Using a third‐generation lentivirus system, lentiviral particles were produced by co‐transfecting 293T cells (CRL‐3216; ATCC) with either pLKO.1‐puro‐shHSPD1 (6 μg) or pLKO.1‐puro‐shControl (6 μg), along with packaging plasmids, including Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendages Article Snippet: Lenti- virus envelope and packaging vector, pCMV- VSV- G and pCMV- dR8.2 dvpr, respectively, were gifts from Article Title: Myristoylated Neuronal Calcium Sensor-1 captures the preciliary vesicle at distal appendages Article Snippet: Lenti-virus envelope and packaging vector, pCMV-VSV-G and pCMV-dR8.2 dvpr, respectively, were gifts from Article Title: Characterization and bioinformatic filtering of ambient gRNAs in single-cell CRISPR screens using CLEANSER. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sgNT-73_gRNA_FW: CGGTGGAGTTTAAGAGCTATGCTG This paper Method Details See Table S6 for lentiviral titration qPCR primers This paper Method Details See Table S7 for individual gRNA oligos This |